Hh150 oil filter cross reference.

CARTRIDGE OIL FILTER. HH150-32094. Kubota Tractor . CARTRIDGE OIL FILTER HH150-32094. Kubota Tractor. CARTRIDGE OIL FILTER. HH150-32094There are 440 replacement oil filters for Fram PH43 . The cross references are for general reference only, please check for correct specifications and measurements for your application. When you click on links to various merchants on this site and make a purchase, this can result in this site earning a commission. HH150-32430: KUBOTA: 51365 : HH150-32430: ... feature or cross reference. Warranties only apply to products selected according to the Vehicle Application Listing ... See cross reference chart for LUBERFINER PH2876 and more than 200.000 other oil filters. ... Kubota HH150-32430 Buy from Amazon; LAND-PRIDE 831-038C ... Luber-Finer PH2876 Engine Oil Filter Replaces 51365 LF113 LF649 57712. $15.99. OIL FILTER. $14.39. K&N Oil Filter. $26.07. Hiflo Oil Filter.Kubota HH150-32094 Buy from Amazon; LAZORLITE L11-1007 ; LAZORLITE L11-1120 ; LAZORLITE L11-1147 ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.

The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 312 replacement oil filters for MOTORCRAFT FL-910S. See cross reference chart for MOTORCRAFT FL-910S and more than 200.000 other oil filters.

Kubota HH150-32430 Oil Filter Replacement, Walker 7023 quantity. Add to cart. SKU: 10883 Categories: Kubota Oil Filters, Walker Mower Parts. Related products. Walker 5727-1 Washer Shim $ 3.54 Add to cart; Walker 5090-2 Vacuator Valve Replacement $ 16.15 Add to cart; Walker 5597 Curb Jumper Ramp

The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 305 replacement oil filters for Fram PH30. See cross reference chart for Fram PH30 and more than 200.000 other oil filters.New OEM Kubota OIL FILTER HH150-32430 Replaces 70000-15241 fits Grasshopper ZTR /supplytheropshop. Recommendations. Jvfnxpm HH150-32430 Oil Filters for Kubota D722 D902 WG750 WG752 WG972 Grasshopper 321D 325 325D 329 432 721 721D 725 729 932 Tractors Replace 70000-15241 100800-2 Pack.The oil filter Cross References are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. Convert one oil filter brand to another. Huge database covering >100 different brands and thousands of oil filters.Kubota HH150-32094 Buy from Amazon; LAZORLITE L11-1147 ... Air Oil Filter Kit AM108184 AM108185 M801209 For John Deere 955 Compact Tractor. $62.50. OIL FILTER. ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.

Feb 13, 2005. #1. Hi I would like some help with finding an cross reference for the oil filter for my 2004 Kubota rtv 900. I haven't had much luck with finding one and think that the price of a oil filter at my dealer is outrages. My dealer wants $9.50 plus tax for an oil filter. the filter number is 15853-32430. Thanks in advance for the help.

OIL FILTER QUICK-REFERENCE GUIDE All listed oil capacities are approximate amounts only and may or may not include the oil fllter capacity. 1006 AWAYS follow proper crankcase drain and flll procedures. Check engine dipstick for proper crankcase oil level. CAPACITY CHARTS MALLORY - 9-57804 Continued 18-7911-1 9-57806 18-7878-1 9-57807 18-7903

Spin-On Lube Filter: Service: Lube/Transmission: Type: Full Flow: Media: Enhanced Cellulose: Height: 2.988 (76)* Outer Diameter Top: 3.234 (82)* Outer Diameter Bottom: ... feature or cross reference. Warranties only apply to products selected according to the Vehicle Application Listing. No product has been certified or warrantied for Aviation ...12 replacement oil filters for KUBOTA HH66036060. See cross reference chart for KUBOTA HH66036060 and more than 200.000 other oil filters. ... The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.GRAND PRIX PH2805 · HASTINGS LF543 · John Deere M801002 · KIOTI E520532091 · Kubota 16271-32090 · Kubota 16271-32092 · Kubota 70000-15241 ...Add to cart. PRODUCT NOTES. Replaces old part numbers KU-15853-32430, KU-15853-32437, KU-15853-32439, KU-15853-99170, KU-15853-99179, KU-70000-15241, and KU …Buy Kubota OEM Oil Filter HH150-32430 and HH1J0-32430: Oil Filters - Amazon.com FREE DELIVERY possible on eligible purchasesOil Filters. $5571. FREE delivery February 21 - 26. Order within 23 hrs 43 mins. Details. Select delivery location. In Stock. Quantity: 1. Ships from.There are 14 replacements for HIFI-FILTER SH60416 . These are indirect matches for KUBOTA HHK7014073. Indirect matches for HIFI-FILTER SH60416. Fleetguard HF29120. Fleetguard LF17543 Buy from Amazon. FRANCE-MOTOCULTURE KUB143682. HASTINGS BT8908 Buy from Amazon. Kubota HHK7014070 Buy from Amazon. Kubota HHK7014073.

Fits For Cummins Onan 122 0893 Oil Filter. $61.67. Onan 122-0893 Oil Filter for Quiet Diesel QD. $53.86. Cummins Power Generation ONAN OIL FILTER 1220893. $75.97. LF3706 Fleetguard Lube Filter, Spin-on Onan 122-0893. $14.95. 6x LF3706 Fleetguard Lube Filter, Spin-on Onan 122-0893.I did some heavy cross referencing and found that the the WIX 51358 was nearly identical in size and worked. I have been using that WIX 51358 and a PartsMaster 61358 ever since. I also understand that a NAPA 41358 (premium filter) will fit as well. The NAPA 21358 (standard filter) should also work.1 PC Oil Filter HH150-32430 Fit For Kubota B7400 BX1860 BX1870 BX2370 RTV900. $18.80. New Engine Filter Maintenance Kit Oil Fuel Air for Kubota BX23S BX1880 BX2380. ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.Engine Oil Filter HH150-32094. Regular price $22.00. Single (Outer) Air Filter 72000-01074. Regular price $30.62. Engine Oil Filter HH164-32430. Regular price $22.00. Deluxe Wheel Spinner. Regular price $41.84. Shopping with us is easy. 100% Certified Kubota Parts. We are Atlantic Canada's largest full line Kubota dealer.Affiliate programs and affiliations include Amazon Associates. Purolator L14459: Filter type: Full-Flow Lube Spin-on. Thread measurement: 20x1.5mm. Outer diameter: 77 mm (Approx. 3.03") Height: 86 mm (Approx. 3.39") Purolator L14459 replacement filters. AC-Delco PF1127.Includes - (1) Oil Filter; comes as shown in the first image ; Note: The manufacturer part number for this item has recently changed from HH150-32430 to HH1J0-32430, the filter for both part numbers is the same ; Please be sure to check your part or model number to ensure this is the correct oil filter for your unit.New Oil Filter For Kubota Z482, HH150-32430 15426-32430 Tractor. $19.90. Oil Filter Wix 51391. $17.59. Wix 51391 Oil Filter NOS. $15.00. Baldwin B7139 Lube Spin-on. ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.

See cross reference chart for HONDA 15400-PR3-004 and more than 200.000 other oil filters. ... Kubota HH150-32094 Buy from Amazon; LAZORLITE L11-1147 ; LAZORLITE L11-1325 ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements.Affiliate programs and affiliations include Amazon Associates. Fram PH8A: Filter type: Full-Flow Lube Spin-on. Thread measurement: 3/4-16. Outer diameter: 97 mm (Approx. 3.82") Height: 130 mm (Approx. 5.12") Fram PH8A replacement filters. AC-Delco PF 56.

Choose brandname and start typing model number. The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 1 replacement oil filter for KUBOTA HHK7014073.JOHN-DEERE M806418 - Alternative oil filters. There are 219 replacement oil filters for JOHN-DEERE M806418 . The cross references are for general reference only, please check for correct specifications and measurements for your application. When you click on links to various merchants on this site and make a purchase, this can result in this ...12 Pack OEM Kawasaki 49065-0721 Oil Filter Replaces 49065-7007. $94.99. The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.For reference only. There are no express or implied warranties with respect to products selected by size, feature or cross reference. Warranties only apply to products selected according to the Vehicle Application Listing. No product has been certified or warrantied for Aviation use.Wix 51064 WIX 51064 Oil Filter. K&N HP-1004 K&N HP-1004 Oil Filter. The Kubota B2650 oil capacity is 4.2 quarts of 10w30 or 15w40. The highest spec oil you can use in your B2650 is Royal Purple. The downside is it’s pretty pricey, but you can get better deals ordering online. Another great option is Rotella T6, which is a little easier to find.Items for cross-reference number HH150-32094. Filters. W 811/80 - MANN-FILTER Oil Filter General information. Code: W 811/80: Brand: MANN-FILTER: Title: Oil Filter ...Kubota #HH164-32430 Eng Oil Filter Parts Hotline 877-260-3528. Stock Orders Placed in 3: 34: 33 Will Ship TODAY. Login 0 Cart 0 Cart Parts Hotline 877-260-3528. HELLO. My Garage Login 0 Cart. HELLO. My Garage . Online Parts . Kubota; New Holland ... Oil drips onto the front axial when you remove the old filter. You may be able …

CARTRIDGE OIL FILTER. HH150-32094. Select Dealer to. See Pricing. Shop online for OEM 000600 Oil Filter parts that fit your Kubota Tractor ZD28, search all our OEM Parts or call at 888-458-2682.

The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 2 replacement oil filters for KUBOTA HH660-36060. See cross reference chart for KUBOTA HH660-36060 and more than 200.000 other oil filters.

Feb 13, 2005. #1. Hi I would like some help with finding an cross reference for the oil filter for my 2004 Kubota rtv 900. I haven't had much luck with finding one and think that the price of a oil filter at my dealer is outrages. My dealer wants $9.50 plus tax for an oil filter. the filter number is 15853-32430. Thanks in advance for the help.YAMAHA 5GH-13440-50 - Alternative oil filters. There are 1 replacement oil filters for YAMAHA 5GH-13440-50 . The cross references are for general reference only, please check for correct specifications and measurements for your application. When you click on links to various merchants on this site and make a purchase, this can result in this ... New Z482 Oil Filter HH150-32430 15426-32430 For Kubota. $29.99. For Kubota HH150-32430 Oil Filter Z482 Engine Spare Parts. $64.19. The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 534 replacement oil filters for ONAN 122-0833. See cross reference chart for ONAN 122-0833 and more than 200.000 other oil filters. ... Kubota HH150-32094 Buy from Amazon; LAZORLITE L11-1147 ... The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements.Filters - Water & Liquids. Filters, Regulators & Lubricators. Fittings - Airline Plastic Quick Tube. Flange Cover. Gate Valve. Gauge Savers. Gauges - Pressure. Gauges - Ring. Gauges - Sight. Gauges - Various. Gauges - Window Sight Glass. Globe Valve. Hot Water Control Valves.Wix Oil Filter 51365XP NEW in Box, Spin-on Lube Filter. $9.99. WIX XP 51365XP Oil Filter - Designed for Full-Synthetic Oils - New. $13.00. WIX 51365XP Transmission Oil Filter for Engine Auto Trans Service is. $19.70. The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements.If you're looking to cross-reference a Kubota D1105 oil filter with another brand, you can use a cross-reference tool to find compatible options. Here are some cross-reference options for the Kubota OEM oil filter HH150-32094: Fram PH6607; Purolator L14670; Bosch 3300; K&N HP-1002;There are 509 replacement oil filters for AC-Delco PF53 . The cross references are for general reference only, please check for correct specifications and measurements for your application. When you click on links to various merchants on this site and make a purchase, this can result in this site earning a commission.Replacement oil filters for KUBOTA HH152-32432 on Ebay. 1 pc Oil Filter 15841-32430 15841-32431 For Kubota G3200 G4200 G5200H G6200H. $19.70. New Filter Kit for Kubota K008 & K008-3 Excavator with D722 Engine (SN 20063) $76.50. Oil Filter 15841-32430 P550726 for Kubota G3200 G4200 G5200H G6200H G1700 G1800. $15.65.

LF3706 Fleetguard Lube Filter, Spin-on Onan 122-0893. $14.95. 6x LF3706 Fleetguard Lube Filter, Spin-on Onan 122-0893. $75.00. (6) LF3706 Fleetguard Lube Filter, Spin-on Onan 122-0893. $69.95. OEM KUBOTA 122-0810 Oil Filter Lube Replaces Onan 122-0893. $19.99. The Air Filter Cross references are for general reference only.KUBOTA HH67037710 - Alternative oil filters. There are 5 replacement oil filters for KUBOTA HH67037710 . The cross references are for general reference only, please check for correct specifications and measurements for your application. When you click on links to various merchants on this site and make a purchase, this can result in this site ...Genuine Kohler 52 050 02-S Oil Filter 5205002-S. $22.67. Rotary Brand Replacement Fits Kohler Oem Oil Filter 5205002S. $17.01. Rotary Brand Replacement Carded Fits Kohler Oem Oil Filter 5205002S1. $20.27. NEW HOLLAND PART PN/ K0H5205002 KOHLER ENGINE FULL FLOW OIL FILTER 5205002. $18.99.1 PC Oil Filter HH150-32430 Fit For Kubota B7400 BX1860 BX1870 BX2370 RTV900. $18.80. New Engine Filter Maintenance Kit Oil Fuel Air for Kubota BX23S BX1880 BX2380. ... The Oil Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk.Instagram:https://instagram. gaston county jail annexhonda odyssey door not closinglong range forecast for gatlinburg tennesseeharbor freight cheektowaga ny When you're looking at numbers for your company and they aren't the best, there's no sense putting one of those Instagram filters on them to make them look better. Your email addre...The Air Filter Cross references are for general reference only. Check for correct application and spec/measurements. Any use of this cross reference is done at the installers risk. 102 replacement oil filters for KUBOTA 16271-32092. See cross reference chart for KUBOTA 16271-32092 and more than 200.000 other oil filters. what is wrong with the following piece of mrna taccaggatcactttgccaclaudia oshry wiki For reference only. There are no express or implied warranties with respect to products selected by size, feature or cross reference. Warranties only apply to products selected according to the Vehicle Application Listing. No product has been certified or warrantied for Aviation use. When you click on links to various merchants on this site and make a purchase, this can result in this site earning a commission. Affiliate programs and affiliations include Amazon Associates. Fram PH8170 replacement filters. APRILIA 82960R. ARIENS 21548100. ARIENS 21550800. BAD-BOY 063-2004-00 Buy from Amazon. BAD-BOY 063-4025-00 … drill clothing company good vibes When you click on links to various merchants on this site and make a purchase, this can result in this site earning a commission. Affiliate programs and affiliations include Amazon Associates. Fram PH3387A: Thread measurement: M18x1.5. Height: 90 mm (Approx. 3.54") Fram PH3387A replacement filters. AC-Delco PF 1225.Wix Filters - Product Catalog search results. Wix or Competitor Part Number - Search results for KUBOTA. This is a valid competitive part number and there is no replacement at this time. Filter data on our website is refreshed regularly and represents the same data available to our corporate offices. For reference only.